Issues with pegRNA spacer / extension sequence alignment

[FC-82]

We are running CRISPResso2 Batch in Prime Editing mode.

Some samples run OK, other samples return following error:

ERROR: The pegRNA spacer aligns to the pegRNA extension sequence in 3'->5' direction. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5'->3' order, and the pegRNA extension sequence (--prime_editing_pegRNA_extension_seq) must be given in the 5'->3' order. In other words, the pegRNA spacer sequence should be found in the given reference sequence, and the reverse complement of the pegRNA extension sequence should be found in the reference sequence.

The only difference between the failed and the OK samples is the length of the prime_editing_pegRNA_extension_seq: length for the OK samples is 25 nt, length of the failed samples is 66 nt. Other than that, they have exactly the same edit, exactly the same spacer, exactly the same amplicon. Also, the short and long extension sequences are given in the same sequence direction.

Any ideas on what's happening here and how to fix it?

Many thanks,

F.C.

[kclem]

Hi @FC-82,

If you're sure you're providing the parameters in the correct orientation, you can get around this by providing the parameter
--prime_editing_override_sequence_checks.

You can find out why this is happening if you run with the --debug flag, which will print more information out about the alignments and the prime-editing sequence orientation checking process.

We expect that the spacer will align to the extension sequence in the forward orientation, and suspect that something may be wrong with the input if it aligns to the reverse. When you run with --debug, it should show something like:

INFO  @ Fri, 26 Apr 2024 10:49:40:
         pegRNA spacer vs extension_seq alignment:
Forward (correct orientation):
TGGAAAGGTCGTTCTTATCC-----------
-------GTCGTTCTTATCCACGTTTCCAGT
Score: 41.935
Reverse (incorrect orientation):
--TGGAAAGGTCGTTCTTATCC--
ACTGGAAACGTGGATAAGAACGAC
Score: 50.0

In this case, the alignment is correct in the Forward (correct orientation) but the score is lower than the Reverse (incorrect orientation) so it throws this error.

In your analysis, the samples fail because for the longer pegRNA extension sequences, there is a place where the spacer aligns better in the reverse orientation than the forward direction.

Let me know if that helps!