Web app analysis issues for multiple samples at once

[jaction24]

Describe the bug
All issues occur when I try running multiple samples at once in the web app (using the blue "+" button to the right of the file and amplicon inputs:

1. When running four samples in HDR mode, I get the following error: ERROR: unsupported operand type(s) for -: 'list' and 'int'
2. When running four samples in Base Editor mode, it will give output for the 2nd, 3rd, and 4th samples but will not give any output for the first sample. Also, it will not allow me to "Download Report" with the blue button at the bottom of the output page
   These all began when there was an update to the site that introduced the green button for batch mode a few months ago. Before that everything worked fine.

Expected behavior
Output produced for all samples without errors. Able to download the final report.

To reproduce
Input four samples into the web app for HDR or Base Editor mode. Errors also seem to occur when running two or three samples at once

Debug output
Execution Log for Run okxdrq9y:
[Command used]:
/var/task/c2/bin/CRISPRessoBatch -p 1 -bs /mnt/efs/UPLOADS/CRISPRessoBatch_0281dde1-c5ce-4ca9-877a-4c7d2325ab41.batch --name okxdrq9y --batch_output_folder /mnt/efs/REPORTS/CRISPRessoBatchRunokxdrq9y --write_cleaned_report --place_report_in_output_folder -e CGCCGAGTTCACCCCTGCGGTGCACGCCTCCCTGGACAAGTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAATACCGTTAAGCTGGAGCCTCGGTAGCCGTTCCTCCTGCCCGCTGGGCCTCCCAACGGGCCCTCCTCCCCTCCTTGCACCGGC --default_min_aln_score 90 -q 0 -s 0 --plot_window_size 20 --min_bp_quality_or_N 0 --exclude_bp_from_left 15 --exclude_bp_from_right 15 --base_editor_output --conversion_nuc_from C --conversion_nuc_to T --prime_editing_pegRNA_extension_quantification_window_size 5 --prime_editing_pegRNA_scaffold_min_match_length 1 -w 1 -wc -3 --use_matplotlib

[Execution log]:
Running CRISPResso with 1 processes
Completed 1/4 runs
Completed 2/4 runs
Completed 3/4 runs
Completed 4/4 runs
Finished all batches
Reporting summary for amplicon: "Reference"
All guides are equal. Performing comparison of batches for amplicon 'Reference'
Plotting nucleotide percentage quilt for amplicon Reference, sgRNA ACCGTCAAGCTGGAGCCTCG
Plotting nucleotide conversion map for amplicon Reference, sgRNA ACCGTCAAGCTGGAGCCTCG
Plotting nucleotide quilt for Reference
Plotting nucleotide conversion map for Reference
Reporting summary for amplicon: "HDR"
All guides are equal. Performing comparison of batches for amplicon 'HDR'

ERROR: unsupported operand type(s) for -: 'list' and 'int'